PCR Primer Tm Calculator
Paste your DNA primer sequences and see their melting temperature calculated instantly. Automatically checks for hairpin loops and structures that could cause your experiment to fail. Nothing leaves your browser.
Forward Primer
Learn more: primer melting temperature (Tm)
Wallace rule and nearest-neighbor
The tool's Wallace rule gives 4 C for each G or C and 2 C for each A or T. An 18-base primer with 8 G or C and 10 A or T comes out at 4 x 8 + 2 x 10 = 52 C. It only needs a base count, so it is quick for a first guess.
The default method is nearest-neighbor thermodynamics with the parameters from SantaLucia's 1998 paper, A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. It adds up a value for every pair of adjacent bases, so base order matters. Wikipedia's nucleic acid thermodynamics article describes the method as treating a helix as a string of interactions between neighboring base pairs.
Here is the effect. GCGCGCAAAAATTTTTGC and CAGACTAGGATAGTTCTC have the same bases and 44% GC, so the Wallace rule gives 52 C for both. With 50 mM Na+ and 0.5 uM primer, nearest-neighbor gives 51.9 C for the first and 44.5 C for the second.
Salt changes the result
Nearest-neighbor values are for 1 M Na+, and the tool then corrects them to your salt. Owczarzy and colleagues' 2004 Biochemistry paper, Effects of sodium ions on DNA duplex oligomers, found that Tm is not linear in ln[Na+] and fitted a quadratic. They report an average error of 1.6 C on an independent test set. The tool uses that equation, which also depends on the primer's GC fraction.
For the 20-base primer AGAGTTTGATCCTGGCTCAG at 0.5 uM, the tool gives 69.7 C at 1 M Na+ and 54.2 C at 50 mM, a drop of 15.5 C. The older rule of 16.6 x log10[Na+] would have taken off 21.6 C, which is too much for a short primer. Magnesium is turned into a sodium equivalent with a factor of 3.3, a rough approximation, so check an enzyme maker's calculator for the exact buffer.
FAQ
Which method should I use?
Nearest-neighbor, because it accounts for base order, as the two same-composition primers show. The Wallace rule is a rough first guess and gives the same answer for any base order.
Why does Tm change when I change the salt?
The calculation starts at 1 M Na+ and corrects down to your buffer. Lower salt gives a lower Tm. The change is bigger for lower salt, so the 50 mM figure in the example is 15.5 C below the 1 M value.
Does it check for hairpins and dimers?
It flags runs of self-complementary bases that might form a hairpin or primer dimer. This is a risk indicator and not a guarantee about how a primer behaves in the lab.